Información

¿Presentan diafonía los represores de fagos CI y Mnt?

¿Presentan diafonía los represores de fagos CI y Mnt?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy interesado en usar las proteínas CI y Mnt, así como sus respectivos promotores (pR y Pmnt) dentro del mismo sistema sintético, pero me preocupa su similitud y posible diafonía. Una búsqueda rápida de la literatura no arrojó resultados y un Multalin mostró alguna homología de secuencia significativa (aunque Mnt forma un homodímero mientras que CI no).

Secuencias: CI y pR, represor Mnt y promotor Mnt

¿Se ha informado alguna vez que el represor CI o Mnt exhibe diafonía en los promotores pR y Pmnt?


Aún no hay informes al respecto. No creo que solo porque muestren una homología general, exhibirán diafonía. Solo vea la alineación de los dominios de unión al ADN de estas proteínas en los primeros 70 residuos del N-terminal. Además, sus DBD pertenecen a diferentes familias de PFAM.

De manera similar con las secuencias promotoras. Como se informó en el sitio web de iGEM:

  • Promotor mnt:tagatctcctatagtgagtcgtattaattt

  • promotor cI:gtgttgactattttacctctggcggtgata

Son bastante diferentes. Además, si iGEM tiene una parte estándar informada, como un componente de sistema biestable: promotor Mnt / cI (BBa_K228003), entonces habría sido bastante estandarizado. Las piezas iGEM suelen ser fiables.


¿Presentan diafonía los represores de fagos CI y Mnt? - biología

La regulación de la expresión génica por represión transcripcional es un mecanismo antiguo y conservado que se manifiesta de diversas formas. Aquí resumimos las vías conservadas para la represión transcripcional que prevalecen en todas las formas de vida, así como los mecanismos indirectos que parecen haberse originado en eucariotas, en consonancia con el entorno de cromatina único de los genes eucariotas. Las interacciones directas entre los represores transcripcionales y la maquinaria transcripcional central en bacterias y arqueas son suficientes para generar un conjunto sofisticado de mecanismos que proporcionan un control flexible. Estas interacciones directas contrastan con la actividad de los correpresores, que proporcionan un control regulador adicional en eucariotas. Su modulación de la estructura de la cromatina representa una vía indirecta para regular a la baja la transcripción, y su diversidad y modulación proporcionan una complejidad adicional adecuada a los requisitos de los patrones de represión eucariotas elaborados. Los nuevos hallazgos indican que los correpresores no están necesariamente restringidos a generar una única salida estereotipada, sino que pueden exhibir diversas respuestas funcionales dependiendo del contexto en el que son reclutados, proporcionando una fuente adicional hasta ahora insospechada de diversidad en el control transcripcional. Los mecanismos dentro de los eucariotas parecen estar altamente conservados, con aspectos novedosos representados principalmente por la adición de andamios de correpresores específicos de linaje que brindan oportunidades adicionales para reclutar la misma maquinaria central.


Ingeniería de control de transcripción y aplicaciones en biología sintética

En biología sintética, los investigadores ensamblan componentes biológicos de nuevas formas para producir sistemas con aplicaciones prácticas. Una de estas aplicaciones prácticas es el control del flujo de información genética (del ácido nucleico a la proteína), también conocida como regulación genética. La regulación es fundamental para optimizar los niveles de proteína (y por lo tanto de actividad) y los niveles subsiguientes de metabolitos y otras propiedades celulares. El dogma central de la biología molecular postula que el flujo de información comienza con la transcripción y, en consecuencia, las herramientas reguladoras dirigidas a la transcripción han recibido la mayor atención en biología sintética. En esta mini revisión, destacamos muchos éxitos pasados ​​y resumimos las lecciones aprendidas en el desarrollo de herramientas para controlar la transcripción. En particular, nos enfocamos en estudios de ingeniería donde los promotores y terminadores de transcripción (cis-factores) se diseñaron directamente y / o se aislaron de bibliotecas de ADN. También revisamos varios reguladores de la transcripción bien caracterizados (trans-factores), dando ejemplos de cómo cis- y trans-factores de acción se han combinado para crear conmutadores digitales y analógicos para regular la transcripción en respuesta a diversas señales. Por último, proporcionamos ejemplos de cómo los sistemas de control de la transcripción diseñados se han utilizado en la ingeniería metabólica y en circuitos genéticos más complicados. Si bien la mayor parte de nuestra mini revisión se centra en la bacteria bien caracterizada Escherichia coli, también proporcionamos varios ejemplos del uso de la ingeniería de control de la transcripción en organismos no modelo. Se han aplicado enfoques similares fuera del reino bacteriano, lo que indica que las lecciones aprendidas de los estudios bacterianos pueden generalizarse para otros organismos.


¿Presentan diafonía los represores de fagos CI y Mnt? - biología

CTXϕ es un bacteriófago filamentoso que codifica la toxina del cólera y se integra en el Vibrio cholerae genoma para formar lisógenos estables. En los lisógenos CTXϕ, la expresión génica que se origina en el rstA El promotor de fagos es reprimido por el represor RstR codificado por fagos. La región N-terminal de RstR contiene un elemento de unión al ADN hélice-vuelta-hélice similar a la hélice-vuelta-hélice de la familia cI / Cro de represores de fagos, mientras que la región C-terminal corta no está relacionada con el dominio de oligomerización de represor cI. RstR marcado con His purificado unido a tres sitios de operador extendidos de 50 pb en el rstA región promotora. Cada una de las huellas de RstR exhibió un patrón escalonado característico de regiones accesibles a la DNasa I que sugirió que RstR se une al ADN como un dímero de dímeros. En experimentos de cromatografía de permeación en gel y reticulación, RstR oligomerizó para formar dímeros y tetrámeros. Se demostró que RstR es tetramérico cuando se une al ADN del operador mediante la realización de experimentos de cambio de movilidad con mezclas de RstR y una variante activa alargada de RstR. Unión de RstR a la alta afinidad O1 El sitio podría ajustarse a un modelo cooperativo de unión de operadores en el que dos dímeros RstR se asocian para formar complejos tetraméricos RstR-operador. La unión de los dímeros RstR a las mitades izquierda o derecha de O1 No se observó ADN del operador en los ensayos de cambio de movilidad. Estas observaciones apoyan un modelo en el que los contactos proteína-proteína entre los dímeros RstR vecinos contribuyen a una fuerte unión del operador.


Control de la expresión génica en los colifagos molde relacionados con P2: III. Secuencia de ADN de la principal región de control del fago 186 ☆, ☆☆

los PstSe ha secuenciado el fragmento I (65,5% a 77,4%) del colifago 186, conocido genéticamente por codificar los principales genes de control, y se ha realizado un análisis para evaluar la capacidad de codificación, las señales de transcripción-traducción y para identificar cualquier otra característica significativa. Nuestro análisis indica que la región codifica: (1) siete genes, incluido el En t y CI genes, que se superponen, el gen de control tardío By dos genes, denominados CP75 y CP76, que codifican proteínas de unión al ADN potenciales (2) un promotor pB y terminador tuberculosis para la transcripción a la derecha del B gen, y predecimos la existencia de esta transcripción en un lisógeno (3) un promotor pL y terminador tL para la transcripción hacia la izquierda que codifica el En t y CI genes, y representa la presunta transcripción lisogénica (4) un promotor pR para que la transcripción hacia la derecha dé la supuesta transcripción lítica (temprana) que se superpone y converge con la transcripción lisogénica y, finalmente (5), un sitio operador potencial para la unión del represor en la región de la pR promotor.

Se presenta evidencia preliminar para apoyar este análisis.


Coevolución de bacterias y sus virus.

La coevolución entre bacterias y bacteriófagos se puede caracterizar como una batalla evolutiva constante infinitiva (carrera de brazo fago-huésped), que comienza durante la adsorción del fago y la penetración en la célula huésped, continúa durante la replicación del fago dentro de las células y permanece preservada también durante la lisogenia del profago. El bacteriófago puede existir dentro de las células bacterianas en cuatro formas con diferentes estrategias evolutivas: como un virus replicante durante el ciclo lítico, en un estado de portador inestable denominado pseudolisogenia, como un profago con genoma completo durante la lisogenia, o como un profago críptico defectuoso. Se caracterizan algunos mecanismos defensivos de las bacterias y las contramedidas de virus, y se discuten algunas cuestiones evolutivas relativas a la relación fago-huésped.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso a artículos por tiempo limitado o completo en ReadCube.

Todos los precios son precios NETOS.


Redes reguladoras de host-profago

Como se mencionó anteriormente, los genes de origen fago representan una gran parte de S. enterica genoma accesorio. Algunos de estos genes contribuyen a la fisiología del hospedador y, por lo tanto, deben expresarse en el momento y el lugar adecuados. Con este fin, pasan a formar parte de la red reguladora bacteriana. ¿Cómo la adquisición de estos nuevos genes no perturba el funcionamiento bacteriano normal? ¿Cómo se integran en la red reguladora del anfitrión? ¿Qué beneficio potencial brindan al huésped bacteriano? ¿Cómo pueden los reguladores bacterianos modular el comportamiento del profago modulando la expresión génica?

Control del huésped negativo de genes profagos

La expresión de nuevos genes no debe ser perjudicial para el huésped bacteriano. Por lo tanto, los genes adquiridos por transferencia horizontal de genes (HGT) generalmente se silencian primero antes de integrarse en la red reguladora del hospedador. El silenciamiento de genes de origen extraño puede ocurrir, por ejemplo, vía Modificación del ADN o implican proteínas reguladoras que se unen al ADN para evitar la transcripción.

Una de las modificaciones del ADN más estudiadas es responsable de una regulación epigenética llamada variación de fase y ocurre solo en una pequeña fracción de la población bacteriana. Esta regulación se basa en la metilación de desoxiadenosinas por la Dam metilasa (Deoxiadenosina metiltransferasa) (Casadesús, 2016). La enzima Dam reconoce y modifica específicamente las secuencias 5′-GATC-3 ′ cuando estas secuencias se localizan en una región promotora, los eventos de metilación pueden bloquear la unión de reguladores transcripcionales y consecuentemente modificar la expresión génica. La metilación del ADN está involucrada en el silenciamiento de genes localizados en los profagos Gifsy1, Fels1 y ST64B en S. enterica SL1344 (Balbontín et al., 2006). Sorprendentemente, regula negativamente la mayoría de los genes ST64B. Esta observación concuerda con resultados previos que muestran que la escisión de ST64B es inhibida por la regulación de Dam (Alonso et al., 2005). Esto se ha atribuido a la regulación a la baja de dos genes ubicados en este profago y que codifican proteínas involucradas en la inducción de fagos: el anti-represor Sb41 y la proteína de replicación Sb42. El regulador bacteriano involucrado en esta regulación y obstaculizado en su función por la metilación de Dam no ha sido identificado hasta la fecha. Mientras que la regulación de Dam observada para los genes ubicados en los profagos Gifsy1 y Fels1 no afecta su escisión, la escisión del profago SopEΦ se ve favorecida por la metilación de Dam. Sin embargo, no se ha descrito ni el regulador transcripcional ni los genes diana responsables de este fenotipo (Alonso et al., 2005 ).

La regulación epigenética también está involucrada en la regulación de la glucosilación del antígeno O (ver la sección de modificación de LPS). De hecho, en condiciones lisogénicas, la expresión del P22 codificado gtrABC El operón está regulado por la metilación de Dam y el regulador bacteriano OxyR (Broadbent et al., 2010 Davies et al., 2013). La región aguas arriba del gtr El operón contiene varios sitios de unión de OxyR así como varios sitios de metilación. Dependiendo del estado de metilación, OxyR se une a diferentes sitios y puede actuar como activador o represor del sistema. La unión de OxyR a un sitio disminuye la metilación de Dam en este sitio y, por lo tanto, aumenta su propia unión. Pero esto también funciona al revés: el aumento de la metilación da como resultado la reducción de la unión de OxyR, lo que favorece la metilación, etc. Esto confiere heredabilidad del estado de expresión al sistema y solo una parte de la población está en un estado "ON", lo que lleva a una población heterogénea (Broadbent et al., 2010 García-Pastor et al., 2018). Se cree que este mecanismo regulador se conserva entre la familia de fagos templados P22 y puede prevenir la superinfección por el mismo u otros fagos que usan correceptor de antígeno O similar durante un tiempo limitado (Davies et al., 2013 ).

Otro factor involucrado en el silenciamiento de genes adquiridos por HGT, además de los genes centrales, es la proteína de unión al ADN H-NS (Lucchini et al., 2006 Navarra et al., 2006). Al unirse preferentemente a secuencias ricas en AT, esta proteína puede discriminar entre lo propio y lo no propio. Curiosamente, varios estudios sugieren que la regulación dependiente de H-NS implicaría diferentes mecanismos para genes ancestrales o genes adquiridos por HGT (Vivero et al., 2008 Baños et al., 2009). Se ha sugerido que los genes ancestrales estarían regulados directamente por la unión de H-NS mientras que los genes adquiridos por HGT requerirían la formación de heterodímeros entre H-NS y proteínas pertenecientes a la familia Hha. Se desconocen qué características del promotor se requieren para favorecer la unión de homodímeros o heterodímeros. En el mismo orden de idea, las proteínas H-NS codificadas por plásmidos conjugativos han evolucionado para regular específicamente genes extraños (Baños et al., 2009 2011). Esto podría deberse a diferencias estructurales entre H-NS codificadas por plásmido o cromosómicamente que conducen a una afinidad diferente por las regiones promotoras. De hecho, aunque se conservan los dominios N- y C-terminales, la región enlazadora presenta cierta variabilidad que podría ser responsable de esta regulación diferencial. Todas estas observaciones se refieren a genes adquiridos por HGT en general, incluidos genes de origen fago. Sin embargo, se ha observado que el contenido de GC de profagos en la cepa de referencia de S. enterica LT2 es similar al contenido medio de GC del genoma (Navarra et al., 2007). Por lo tanto, podemos preguntarnos si las conclusiones anteriores se aplican realmente a los genes de origen profago. Hasta ahora faltan estudios que se centren específicamente en la regulación de estos genes y es necesario realizarlos para responder a esta pregunta. Sin embargo, el trabajo en curso en nuestro laboratorio sugiere que H-NS regula genes profagos que no han sido identificados por enfoques globales en S. enterica ST4 / 74 y que estas regulaciones tienen consecuencias sobre el mantenimiento de profagos en el cromosoma del huésped (Wahl et al., inédito).

Control positivo del huésped de genes profagos

Además de la regulación negativa que acabamos de mencionar, algunos reguladores bacterianos también regulan positivamente genes de origen profago. Sorprendentemente, si se observan los diferentes estudios transcriptómicos realizados en S. enterica Para definir los objetivos de un regulador global como PhoP, SlyA, ArcA, FNR o RpoS, solo se identificaron un puñado de genes profagos (Navarra et al., 2005 Fink et al., 2007 Evans et al., 2011 Lévi-Meyrueis et al., 2015). Además, rara vez se examinan los mecanismos moleculares que conducen a estas regulaciones o las consecuencias sobre la fisiología bacteriana. No es sorprendente que lo que más se ha estudiado es la regulación de genes que codifican proteínas implicadas en la virulencia y la colonización del huésped. Estos estudios han demostrado que los genes bajo el control de reguladores bacterianos son imbéciles, lo que define genes regulados independientemente del resto del profago y que confieren una ventaja (efecto de aptitud en condiciones específicas como la virulencia) al huésped. Entre ellos, se encuentran varias proteínas efectoras secretadas por T3SS. Como se ha mencionado más arriba, S. enterica posee dos T3SS codificados por la isla de patogenicidad 1 y 2 (SPI1 y 2). Entre los reguladores conocidos por controlar la expresión de genes ubicados en el SPI se encuentran el regulador transcripcional InvF perteneciente a la familia AraC / XylS para SPI1, regulado a su vez por el regulador maestro HilD, y el sistema de dos componentes SsrAB para SPI2. Aunque inicialmente se pensó que ambos reguladores solo estaban dedicados a la regulación de genes ubicados en SPI1 y 2, también regulan la expresión de efectores codificados por profagos. De hecho, InvF regula los efectores de origen profago secretados por SPI1, mientras que SsrAB controla los efectores que son dependientes de SPI2.

Por ejemplo, SopE es un factor de virulencia codificado en el profago SopEΦ en S. enterica SL1344 y secretada por el sistema SPI1. Como consecuencia, sopE La expresión está regulada por InvF, en asociación con la proteína acompañante SicA (Darwin y Miller, 2000). El papel de SicA es probablemente indirecto, al estabilizar o permitir la función de un regulador transcripcional hasta ahora no identificado involucrado en sopE regulación (Tucker y Galán, 2000).

Otros efectores codificados por profagos son secretados por SPI2 y, como consecuencia, su expresión depende del sistema de dos componentes SsrAB. Entre ellos, GogB está codificado por el primer gen del profago Gifsy1 en S. enterica SL1344. Curiosamente se ha demostrado que gogB La expresión es independiente de los factores de profago de Gifsy1, ya que puede transferirse por sí mismo en el organismo enteropatógeno. E. coli cepa E2348 / 69, expresada a partir de su propio promotor y secretada vía el T3SS de su nuevo anfitrión. Esto muestra que gogB se puede integrar fácilmente en la red reguladora del anfitrión (Coombes et al., 2005). El contenido de GC de gogB muestra diferencias con el contenido de GC de Gifsy1, lo que sugiere que este gen ha sido adquirido recientemente por el profago. Es más, gogB se puede encontrar fuera de Gifsy1 y no siempre está codificado por profago, lo que respalda aún más su independencia transcripcional del profago Gifsy1 (Porwollik et al., 2002 ).

sseI es un gen ubicado en el profago Gifsy2, que codifica otro efector T3SS. sseI La expresión está fuertemente activada por la unión directa de la forma fosforilada de SsrB en su región promotora (Worley et al., 2000 Feng et al., 2004 ). sseI La expresión también está regulada por la forma fosforilada de OmpR, pero no está claro si esta regulación es directa o dependiente de SsrB (Feng et al., 2004). Curiosamente, la pseudogeneización de sseI junto con la expresión superior de pgtE, que codifica una proteína de la membrana externa, permite S. enterica Adaptación de ST313 para causar enfermedad sistémica (Carden et al., 2017 Hammarlöf et al., 2018). El aumento en pgtE la transcripción se debe a un solo SNP en su región promotora. Se requieren más estudios para comprender cómo estos cambios en la expresión génica modifican S. enterica Comportamiento ST313 (Hammarlöf et al., 2018 ).

SsrB también regula genes en el remanente de fago SPI12. Entre los genes regulados, STM2239 codifica una proteína antiterminador Q que interactúa con la ARN polimerasa para facilitar la transcripción de promotores tardíos. La ausencia de STM2239 afecta la aptitud de las bacterias dentro del huésped. STM2239 permite la transcripción de genes codificados por fagos, pero también de genes bacterianos implicados en vías metabólicas, incluida la modificación y el transporte de ribosa, la síntesis y reciclado de acetil coenzima A, así como el metabolismo de la galactosa. Ninguna de estas regulaciones se ha caracterizado más, pero se ha especulado que algunas de ellas pueden ser importantes para S. enterica aptitud dentro del anfitrión (Tomljenovic-Berube et al., 2013 ).

Genes bacterianos controlados por fagos

A excepción de la virulencia, los ejemplos de procesos bacterianos bajo control de profagos son escasos (Figura 1 y subpunto 1.2 del Cuadro 1). Sin embargo, P22 ofrece una buena ilustración de genes bacterianos que codifican proteínas involucradas en el metabolismo y bajo el control de un regulador de origen fago. los dgo El operón participa en la captación y el metabolismo del D-galactonato, una importante fuente de carbono durante la proliferación intracelular. En S. enterica Cepa LT2, expresión de la dgo El operón se desreprime en presencia de Pid, ​​una proteína codificada en un locus de moron en P22 (Cenens et al., 2013a 2013b). Esta regulación solo ocurre cuando P22 sufre pseudolisogenia, lo que sugiere la existencia de un programa genético dedicado en esta condición.

La regulación dependiente de fagos se puede conservar entre bacterias estrechamente relacionadas. Es el caso de la pckA gen que codifica una fosfoenolpiruvato carboxiquinasa necesaria para la gluconeogénesis. En E. coli, este gen está bajo el control del represor CI del fago λ (Chen et al., 2005). Curiosamente, pckA La región reguladora se conserva entre Enterobacterias y contiene secuencias homólogas a varios operadores de fagos, siendo uno de ellos el sitio de unión para el represor C2 de P22. Esta regulación compartida entre varios profagos podría ser parte de una estrategia adaptativa para aumentar la aptitud de los lisógenos al reducir su tasa de crecimiento en condiciones limitadas de glucosa (Chen et al., 2005 ).

Los profagos a menudo se integran en genes que codifican ARNt. Un contraejemplo lo da el fago ΦW104 que integra el cromosoma del huésped en un locus que codifica el ARNs de RyeA y RyeB ubicado en la hebra de ADN opuesta en S. enterica DT104 (Balbontín et al., 2008). El sitio de conexión para ΦW104 está dentro de los 23 últimos pares de bases de centeno y corresponde a un sitio interno en centeno. Por lo tanto, la lisogenización de ΦW104 modifica la porción 5 ′ de centeno, lo que lleva a una disminución de la transcripción de centeno y una mayor transcripción de centeno. Esta regulación transcripcional tiene probables consecuencias fisiológicas en el hospedador bacteriano, al modificar la expresión de las dianas de ARNm de RyeA y RyeB.

Finalmente, otro ejemplo de regulación del gen del huésped involucra un gen ubicado en el profago Gifsy1, isrK (Hershko-Shalev et al., 2016). Este gen codifica un ARNm y un ARNm policistrónico largo que comprende isrK, orf45, ANRP y isrJ secuencias de codificación. Sin embargo, no se observa traducción de este ARNm a menos que esté presente ARNm de IsrK. De hecho, el ARNs de IrsK se une al orf45 sitio de unión del ribosoma y facilita la unión de la subunidad ribosómica 30S a este sitio, lo que lleva a la traducción de secuencias aguas abajo y la producción de la proteína AnrP. AnrP es un anti-represor que activa la transcripción de genes codificados por fagos. Entre ellos, activa la expresión del hormiga gen que codifica el anti-terminador de AntQ que interactúa y forma un complejo estable con la ARN polimerasa. Esto conduce a un alargamiento transcripcional aberrante, daño del ADN y, en última instancia, muerte celular (Hershko-Shalev et al., 2016 ).

Todos los ejemplos anteriores se refieren a la regulación de la expresión génica. Sin embargo, los fagos también pueden influir en la fisiología bacteriana por otros medios. Por ejemplo, la liberación de colicina 1b en S. enterica SL1344 depende de los genes de lisis del profago ST64B (Nedialkova et al., 2015). De hecho, en condiciones específicas como daño al ADN o limitación de hierro, la colicina 1b se acumula en la célula y necesita la inducción de genes de lisis ST64B para encontrarla en el medio extracelular. Curiosamente, la diafonía compleja entre ST64B y otros profagos presentes en esa cepa contribuye a esta regulación y necesita una mayor caracterización.


Material y métodos

Material vegetal, condiciones de crecimiento y plásmidos.

Zea mays cv Early Golden Bantam (EGB Olds Seeds, Madison, WI, EE. UU.) se utilizó para la infección con U. maydis. El maíz se cultivó en un invernadero (16 h: 8 h, ciclo luz: oscuridad, 28 ° C: 20 ° C). Nicotiana benthamiana las plantas se cultivaron en una cámara de crecimiento (16 h: 8 h, ciclo de luz: oscuridad, 22 ° C, 60% de humedad). Arabidopsis thaliana Las líneas inducibles por β-estradiol XVE-jsi1-mCherry y las líneas de control XVE-mCherry se crearon mediante la inserción de ADN de transferencia en el fondo Col-0. Arabidopsis thaliana las plantas se cultivaron en una cámara de crecimiento (12 h: 12 h, ciclo luz: oscuridad, 21 ° C, 60% de humedad). Todos los plásmidos utilizados en este trabajo se proporcionan en la Tabla de información complementaria S1. En los Métodos S1 se proporcionan clonación detallada, números de acceso de genes, ensayo de virulencia y mediciones de fitohormonas.

Experimentos de secreción en cultivo axénico y en planta

Ustilago maydis cepa AB33Potefjsi1-3xHA se generó mediante la inserción del plásmido pUG-Potef-Jsi1-3xHA en el ip locus de AB33 según Aichinger et al. (2003). Realizamos el ensayo de secreción según Brachmann et al. (2001). Se utilizaron anticuerpos monoclonales de ratón anti-hemaglutinina (HA Sigma Aldrich) y anti-actina (Invitrogen) para Western blot. El experimento se repitió con tres cepas transformantes independientes con resultados similares.

Para visualizar la secreción de proteínas. en planta, generamos el SG200Δjsi1PAGcmu1Jsi1mCherry cepa integrando Jsi1-mCherry bajo el control de la cmu1 promotor en el ip lugar. Además, construimos una versión no secreta de la cepa Jsi1-mCherry (SG200Pcmu1Jsi127641mCherry). Independientemente infectamos ambas cepas en plántulas de maíz de 7 días de edad. La señal de fluorescencia de mCherry se detectó mediante microscopía confocal a los 3 días después de la infección (dpi).

Ensayo de levadura de dos híbridos

Realizamos ensayos de levadura de dos híbridos (Y2H) con el sistema Matchmaker ™ GAL4 Two híbrido (Clontech®, Mountain View, CA, EE. UU.) Siguiendo el protocolo del fabricante. Fusionamos el dominio de activación GAL4 del vector de presa pGG446 (versión modificada de pGADT7) a los genes Jsi127641, Jsi1m27641, ZmERF4y proteína amarilla fluorescente (YFP). Fusionamos el dominio de unión GAL4 del vector cebo pGG187 (versión modificada de pGBKT7) a los genes ZmTPL1, ZmTPL2, ZmTPL3, TPL (AT1G15750), TPR1 (AT1G80490), TPR2 (AT3G16830), TPR4 (AT3G15880), YFP, y porciones N y C-terminales de los diferentes ortólogos en topless. Transformamos las combinaciones de los vectores pGG446 y pGG187 que llevan los diferentes genes en las cepas de levadura Y187 (MAT α) y AH109 (MAT a), respectivamente. Seleccionamos levadura diploide después del apareamiento para el crecimiento en las placas (SD) −Leu / −Trp y (SD) −Leu / −Trp / −His a 28 ° C durante 4 d. Repetimos los experimentos dos veces a partir de eventos de apareamiento independientes.

Ensayo de co-inmunoprecipitación en N. benthamiana y Z. mays

Nos infiltramos 4 semanas de edad N. benthamiana se va con Agrobacterium tumefaciens que llevan diferentes genes clonados en un vector de expresión como se describe (Ma et al., 2012). Los cultivos que llevan las diferentes combinaciones de genes se infiltraron en seis hojas (tres plantas, dos hojas de cada planta). Se suspendió una muestra de 450 mg de polvo de tejido en 2 ml de tampón de extracción frío para la extracción de proteínas (Hepes 50 mM pH 7,5, cloruro de sodio 100 mM, glicerol al 10% v / v, EDTA 1 mM, Triton X-100 al 0,1% v / v , Polivinilpolipirrolidona al 2%, ditiotreitol 1 mM, fluoruro de fenilmetanosulfonilo 1 mM y cóctel de inhibidor de proteasa sin EDTA Roche). La extracción de proteínas se realizó utilizando el sistema μMACS ™ MicroBeads de Miltenyi Biotech (Bergisch Gladbach, Alemania) siguiendo las instrucciones del fabricante.

Cuantificamos las señales de proteínas de ZmTPL1, ZmERF4 y las diferentes versiones de Jsi1 en la entrada. Las señales de proteína de ZmTPL1, ZmERF4 y las diferentes versiones de Jsi1 se normalizaron a la señal de proteína de Rubisco (Ponceau) respectiva. El cambio de pliegues (FC) para cada proteína se mostró en relación con el valor de proteína normalizado observado en ZmTPL1 coexpresado con YFP o Jsi1 y ZmERF4. La cuantificación de la señal de proteínas reducidas de ZmERF4 y las diferentes versiones de Jsi1 se normalizaron a sus respectivas señales de proteína ZmTPL1 reducidas. La FC para cada proteína se mostró en relación con el valor de ZmTPL1 coexpresado con Jsi1 y ZmERF4. Los valores de FC ± SD son medias de tres réplicas biológicas para todos los experimentos.

En el caso del maíz, U. maydis cepas SG200Pcmu1jsi1-3xHA, SG200Pcmu1jsi1m-3xHAy SG200Pcmu1-SPcmu1 (1-22)-mCherry-3xHA fueron generados por la integración de los diferentes constructos en el ip locus de SG200. Infectamos plántulas de 7 días de edad con cada cepa (30 plantas por cepa). El tejido infectado se recogió 7 dpi. El protocolo de co-inmunoprecipitación (Co-IP) fue el mismo que para N. benthamiana.

Detectamos las proteínas inmunoprecipitadas con anticuerpos anti-MYC (Sigma Aldrich), anti-HA, anti-mCherry (Abcam) o anti-proteína fluorescente verde (GFP Miltenyi Biotech) según el experimento. El anticuerpo específico de TPL se generó usando un péptido pequeño, CNEQLSKYGDTKSAR, seleccionado de una región conservada de las proteínas TPL / TPR. El anticuerpo policlonal fue producido en conejo por Eurogentec (Seraing, Bélgica). Repetimos cada experimento tres veces.

Arabidopsis thaliana Recolección de muestras de secuenciación de ARN

Arabidopsis thaliana Las semillas de las líneas XVE-jsi1-mCherry-1/2 y XVE-mCherry se cultivaron verticalmente en placas cuadradas que contenían medio Murashige & Skoog durante 7 d. Arabidopsis thaliana las plántulas se transfirieron a placas cuadradas con el mismo medio que contenía β-estradiol 5 µM y se incubaron durante 6 h. Se recolectaron tres réplicas independientes para cada genotipo. El tratamiento simulado solo se realizó para la línea de control para confirmar que la concentración de β-estradiol usada para el experimento no alteró por sí misma la expresión génica.

Análisis de secuenciación de ARN

Eliminamos las secuencias de adaptadores y realizamos un recorte de calidad utilizando T rimmomatic (Bolger et al., 2014). Las lecturas se asignaron al genoma de referencia utilizando S TAR, v.2.7.0e (Dobin et al., 2013) con el parámetro outFilterMismatchNoverLmax 0.05. Ingresamos los archivos bam a R v.3.5.1 usando el paquete R / samtools. Obtuvimos la anotación del genoma de Araport11 y los modelos de genes y los recuentos de lectura por gen se obtuvieron con los paquetes G enomic F ecesures y G enomic A lignments, respectivamente. Eliminamos genes de baja expresión y analizamos 28843 para la expresión diferencial usando DES eq 2 después de realizar la transformación logarítmica regularizada (Love et al., 2014). Comparamos todas las réplicas de las líneas XVE-jsi1-mCherry inducidas por β-estradiol con las réplicas de las líneas de control XVE-mCherry con y sin inducción de β-estradiol y mantuvimos los genes con log FC ˃ 1,5 y ajustados PAG & lt 0,05. Realizamos análisis a término de Ontología Genética (GO) para procesos biológicos utilizando la herramienta T hale M ine (Krishnakumar et al., 2014). Los conjuntos de datos se depositaron en el Ómnibus de expresión génica del Centro Nacional de Información Biotecnológica (NCBI) y se puede acceder a ellos a través del número de acceso de la serie GEO. GSE142128 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE142128).

Para evaluar la importancia del enriquecimiento para los sitios de unión de TF, primero determinamos los genes diana directos de ERF3, 4, 7, 8, 10, 11 y ZAT10 utilizando los datos disponibles de secuenciación de purificación por afinidad de ADN (DAP-seq) (O’Malley et al., 2016). Superponemos cada lista de genes diana directos putativos con genes regulados positivamente en jsi1 inducción (FC ˃ 1,5, PAG & lt 0,05). Determinamos la importancia de los genes superpuestos con la prueba exacta de Fisher utilizando el paquete R geneoverlap función newGOM (https://github.com/shenlab-sinai/GeneOverlap).

PCR de transcripción inversa para la validación de secuenciación de ARN

El ARN total se extrajo de tres réplicas independientes de cada A. thaliana line (XVE-jsi1-mCherry-1 y 2 y XVE-mCherry) usando el mismo protocolo para muestras de secuenciación de ARN (RNA-seq). Se generó ADN complementario (ADNc) a partir de ARN total utilizando el kit de síntesis de ADNc iScript (Bio-Rad). Realizamos transcripción inversa cuantitativa (qRT) -PCR utilizando FastStart Universal SYBR Green Master mix (Roche) de acuerdo con las instrucciones del fabricante. La cantidad relativa de amplicones en las muestras se calculó con el método (Livak & Schmittgen, 2001) con actina2 (AT3G18780) como gen de referencia (Czechowski et al., 2005). Calculamos FC en el nivel de expresión de cada gen en las líneas XVE-jsi1-mCherry en comparación con la línea XVE-mCherry, y los datos se representan para cada línea jsi1-mCherry como la media de tres repeticiones. Calculamos diferencias estadísticamente significativas en la expresión génica entre cada línea jsi1-mCherry y línea mCherry usando ANOVA seguido de la prueba de comparación múltiple de Dunnett con PAG & lt 0,05.

Para la evaluación de la inducción de la rama ERF en maíz, se recolectaron 10 plántulas de EGB infectadas con SG200 a 4 y 6 dpi. Las plántulas simuladas se infectaron con agua y se recogió tejido para cada punto de tiempo. Se realizaron tres réplicas independientes para tejido infectado y simulado en cada punto de tiempo. La extracción de ARN, la síntesis de ADNc y la qRT-PCR y el análisis de datos se realizaron como se describió anteriormente, pero utilizando una quinasa dependiente de ciclina (CDK GRMZM2G149286) como gen de referencia (Lin et al., 2014). Los cebadores utilizados para RT-PCR se describen en la Tabla S2.

Transformación biolística de maíz para localización y análisis de inducción genética

Bombardeamos hojas de maíz de 6 días con partículas de oro de 1,6 µm recubiertas con 5 µg de cada plásmido como lo describe Djamei. et al., (2011). Se observó emisión de fluorescencia 1 día después de la transformación mediante microscopía confocal. For gene induction analysis, we bombarded 7 µg of the corresponding plasmids (35S-Jsi1-mcherry or 35S-Jsi1m-mcherry) into 12-d-old maize leaves. Samples were harvested 10 h after bombardment for RNA extraction and qRT-PCR.

Identification of putative secreted effector proteins with a DLNxxP motif

We downloaded predicted protein sequences of the different plant pathogens from EnsemblFungi (https://fungi.ensembl.org/index.html) or NCBI (https://www.ncbi.nlm.nih.gov/). To identify putative secreted effector proteins with a DLNxxP motif, we searched for the DLNxxP motif in all predicted proteins from the different fungal species using CLC M ain W orkbench 7.7.2 (Qiagen). Among all the DLNxxP-motif-containing proteins, we searched for those with a predicted secretion signal (S ignal IP-5.0), lacking transmembrane domains (T mhmm v . 2.0 from http://www.cbs.dtu.dk/services/), and no predicted enzymatic domains (I nter P ro , https://www.ebi.ac.uk/interpro/beta/).


Aplicaciones

Bacteria and yeast are already used in numerous biotechnology applications such as fermentation and drug synthesis. The ability to engineer multicellular systems will drive vast improvements in existing applications as well as open up a wide variety of new possibilities. For example, programmed coordination of engineered bacteria or yeast can eliminate the need for monitoring of batch cultures and control of gene expression in such cultures through addition of expensive inducers ( Farmer and Liao, 2000 Chen and Weiss, 2005 ). New applications can be obtained by coupling gene regulatory networks with biosensor modules and biological response systems. Researchers interfaced a toggle switch with the SOS pathway detecting DNA damage as the biosensor module and biofilm formation as response output ( Kobayashi et al, 2004 ). Exposure of engineered cells to transient UV irradiation caused DNA damage, triggering the toggle switch to flip to the state that induced the formation of biofilms. In a similar study, a toggle switch was interfaced with the transgenic V. fischeri quorum-sensing module to sense when cells reach a critical threshold density. Engineering interactions between programmed bacteria and mammalian cells will lead to exciting medical applications. Recientemente, E. coli cells were engineered to invade specific mammalian cells exhibiting tumorigenic properties. Different plasmids were built containing the inv gene from Yersinia pseudotuburculosis under control of the Lux promoter, the hypoxia-responsive fdhF promoter, and the arabinose-inducible araBAD promoter. E. coli harboring these plasmids invaded cancer-derived cells in a density-dependent fashion, under anaerobic growth conditions, and upon arabinose induction, respectively ( Anderson et al, 2005). Synthetic biology will help the treatment of disease move beyond traditional approaches by allowing us to develop ‘smart’ therapies, where the therapeutic agent can perform computation and logic operations and make complex decisions. Also, the ability to engineer synthetic systems that can form spatial patterns is a critical step towards tissue engineering and fabrication of biomaterials ( Basu et al, 2005). Synthetic biology will open the doors to promising new applications, such as the production of alternative energy sources in live cells, biological computing, and bio-directed fabrication.


Footnotes

Ahmed, S. A., Awosika, J., Baldwin, C., Bishop-Lilly, K. A., Biswas, B., Broomall, S., et al. (2012). Genomic comparison of Escherichia coli O104:H4 isolates from 2009 and 2011 reveals plasmid, and prophage heterogeneity, including Shiga toxin encoding phage stx2. PLoS One 7:e48228. doi: 10.1371/journal.pone.0048228

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Herramienta básica de búsqueda de alineación local. J. Mol. Biol. 215, 403�. doi: 10.1016/S0022-2836(05)80360-2

Appleyard, R. K. (1954). Segregation of new lysogenic types during growth of a doubly lysogenic strain derived from Escherichia Coli K12. Genética 39, 440�.

Aravind, L., Leipe, D. D., and Koonin, E. V. (1998). Toprim𠄺 conserved catalytic domain in type IA and II topoisomerases, DnaG-type primases, OLD family nucleases and RecR proteins. Ácidos nucleicos Res. 26, 4205�. doi: 10.1093/nar/26.18.4205

Balasubramanian, S., Osburne, M. S., BrinJones, H., Tai, A. K., and Leong, J. M. (2019). Prophage induction, but not production of phage particles, is required for lethal disease in a microbiome-replete murine model of enterohemorrhagic E. coli infección. PLoS Pathog. 15:e1007494. doi: 10.1371/journal.ppat.1007494

Bednarz, M., Halliday, J. A., Herman, C., and Golding, I. (2014). Revisiting bistability in the lysis/lysogeny circuit of bacteriophage lambda. PLoS One 9:e100876. doi: 10.1371/journal.pone.0100876

Beutin, L., Hammerl, J. A., Strauch, E., Reetz, J., Dieckmann, R., Kelner-Burgos, Y., et al. (2012). Spread of a distinct Stx2-encoding phage prototype among Escherichia coli O104:H4 strains from outbreaks in Germany, Norway, and Georgia. J. Virol. 86, 10444�. doi: 10.1128/JVI.00986-12

Bielaszewska, M., Mellmann, A., Zhang, W., Kཬk, R., Fruth, A., Bauwens, A., et al. (2011). Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. Lancet Infect. Dis. 11, 671�. doi: 10.1016/S1473-3099(11)70165-7

Boudailliez, B., Berquin, P., Mariani-Kurkdjian, P., Ilef, D. D., Cuvelier, B., Capek, I., et al. (1997). Possible person-to-person transmission of Escherichia coli O111 – associated hemolytic uremic syndrome. Pediatr. Nephrol. 11, 36�. doi: 10.1007/s004670050229

Carter, C. C., Fierer, J., Chiu, W. W., Looney, D. J., Strain, M., and Mehta, S. R. (2016). A novel Shiga toxin 1a-converting bacteriophage of Shigella sonnei with close relationship to Shiga toxin 2-converting pages of Escherichia coli. Open Forum Infect. Dis. 3:ofw079. doi: 10.1093/ofid/ofw079

Casjens, S. R., and Hendrix, R. W. (2015). Bacteriophage lambda: early pioneer and still relevant. Virología 479�, 310�. doi: 10.1016/j.virol.2015.02.010

Croucher, N. J., Page, A. J., Connor, T. R., Delaney, A. J., Keane, J. A., Bentley, S. D., et al. (2015). Rapid phylogenetic analysis of large samples of recombinant bacterial whole genome sequences using Gubbins. Ácidos nucleicos Res. 43:e15. doi: 10.1093/nar/gku1196

Eppinger, M., Mammel, M. K., Leclerc, J. E., Ravel, J., and Cebula, T. A. (2011). Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U.S.A. 108, 20142�. doi: 10.1073/pnas.1107176108

Fogg, P. C. M., Saunders, J. R., McCarthy, A. J., and Allison, H. E. (2012). Cumulative effect of prophage burden on Shiga toxin production in Escherichia coli. Microbiology (Reading) 158, 488�. doi: 10.1099/mic.0.054981-0

Frank, C., Werber, D., Cramer, J. P., Askar, M., Faber, M., an der Heiden, M., et al. (2011). Epidemic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. N. Engl. J. Med. 365, 1771�. doi: 10.1056/NEJMoa1106483

Fuller, C. A., Pellino, C. A., Flagler, M. J., Strasser, J. E., and Weiss, A. A. (2011). Shiga toxin subtypes display dramatic differences in potency. Infectar. Immun. 79, 1329�. doi: 10.1128/IAI.01182-10

Gamage, S. D., Patton, A. K., Hanson, J. F., and Weiss, A. A. (2004). Diversity and host range of Shiga toxin-encoding phage. Infectar. Immun. 72, 7131�. doi: 10.1128/IAI.72.12.7131-7139.2004

Gamage, S. D., Strasser, J. E., Chalk, C. L., and Weiss, A. A. (2003). Nonpathogenic Escherichia coli can contribute to the production of Shiga toxin. Infectar. Immun. 71, 3107�. doi: 10.1128/iai.71.6.3107-3115.2003

Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P., and Blinov, V. M. (1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Ácidos nucleicos Res. 17, 4713�. doi: 10.1093/nar/17.12.4713

Gorbalenya, E. A., and Koonin, E. V. (1993). Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 3, 419�. doi: 10.1093/nar/26.2.391

Gordon, D. M., and O𠆛rien, C. L. (2006). Bacteriocin diversity and the frequency of multiple bacteriocin production in Escherichia coli. Microbiology (Reading) 152, 3239�. doi: 10.1099/mic.0.28690-0

Grad, Y. H., Lipsitch, M., Feldgarden, M., Arachchi, H. M., Cerqueira, G. C., FitzGerald, M., et al. (2012). Genomic epidemiology of the Escherichia coli O104:H4 outbreaks in Europe, 2011. Proc. Natl. Acad. Sci. ESTADOS UNIDOS. 109, 3065�. doi: 10.1073/pnas.1121491109

Grande, L., Michelacci, V., Tozzoli, R., Ranieri, P., Maugliani, A., Caprioli, A., et al. (2014). Whole genome sequence comparison of vtx2-converting phages from enteroaggregative haemorrhagic Escherichia coli son. BMC Genomics 15:574. doi: 10.1186/1471-2164-15-574

Hanahan, D. (1985). “Techniques for transformation of Escherichia coli,” in DNA Cloning: A Practical Approach, ed. D. M. Glover (McLean, VA: IRL Press), 109.

Iversen, H., L’ Abພ-Lund, T. M., Aspholm, M., Arnesen, L. P., and Lindb์k, T. (2015). Commensal E. coli Stx2 lysogens produce high levels of phages after spontaneous prophage induction. Parte delantera. Celda. Infectar. Microbiol. 5:5. doi: 10.3389/fcimb.2015.00005

Kaiser, A. D. (1957). Mutations in a temperate bacteriophage affecting its ability to lysogenize Escherichia coli. Virología 3, 42�. doi: 10.1016/0042-6822(57)90022-3

Katz, L. S., Griswold, T., Morrison, S. S., Caravas, J. A., Zhang, S., den Bakker, H. C., et al. (2019). Mashtree: a rapid comparison of whole genome sequence files. J. Open Source Softw. 4, 1762�. doi: 10.21105/joss.01762

Kimsey, H. H., and Waldor, M. K. (2009). Vibrio cholerae LexA coordinates CTX prophage gene expression. J. Bacteriol. 191, 6788�. doi: 10.1128/JB.00682-09

Kozłowska, K., Glinkowska, M., Boss, L., Gaffke, L., Deptuᐪ, J., and Wêgrzyn, G. (2020). Formation of complexes between O proteins and replication origin regions of Shiga toxin-converting bacteriophages. Parte delantera. Mol. Biosci. 7:207. doi: 10.3389/fmolb.2020.00207

Krüger, A., and Lucchesi, P. M. (2015). Shiga toxins and stx phages: highly diverse entities. Microbiology (Reading) 161, 451�. doi: 10.1099/mic.0.000003

Kulasekara, B. R., Jacobs, M., Zhou, Y., Wu, Z., Sims, E., Saenphimmachak, C., et al. (2009). Analysis of the genome of the Escherichia coli O157:H7 2006 spinach-associated outbreak isolate indicates candidate genes that may enhance virulence. Infectar. Immun. 77, 3713�. doi: 10.1128/IAI.00198-09

L�ພ-Lund, T. M., Jørgensen, H. J., O’Sullivan, K., Bohlin, J., Ligård, G., Granum, P. E., et al. (2012). The highly virulent 2006 Norwegian EHEC O103:H25 outbreak strain is related to the 2011 German O104:H4 outbreak strain. PLoS One 7:e31413. doi: 10.1371/journal.pone.0031413

Lemire, S., Figueroa-Bossi, N., and Bossi, L. (2011). Bacteriophage crosstalk: coordination of prophage induction by trans-acting antirepressors. PLoS Genet. 7:e1002149. doi: 10.1371/journal.pgen.1002149

Licznerska, K., Nejman-Faleᑌzyk, B., Bloch, S., Dydecka, A., Topka, G., Gąsior, T., et al. (2016). Oxidative stress in Shiga toxin production by enterohemorrhagic Escherichia coli. Oxid. Medicina. Celda. Longev. 2016:3578368. doi: 10.1155/2016/3578368

Loś, J. M., Loś, M., and Wêgrzyn, G. (2011). Bacteriophages carrying Shiga toxin genes: genomic variations, detection and potential treatment of pathogenic bacteria. Future Microbiol. 6, 909�. doi: 10.2217/fmb.11.70

Makino, K., Yokoyama, K., Kubota, Y., Yutsudo, C. H., Kimura, S., Kurokawa, K., et al. (1999). Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 genes of the enterohemorrhagic Escherichia coli O157:H7 derived from the Sakai outbreak. Genes Genet. Syst. 74, 227�. doi: 10.1266/ggs.74.227

Mardanov, A. V., and Ravin, N. V. (2007). The antirepressor needed for induction of linear plasmid-prophage N15 belongs to the SOS regulon. J. bacteriol. 189, 6333�. doi: 10.1128/JB.00599-07

Mellmann, A., Bielaszewska, M., Kཬk, R., Friedrich, A. W., Fruth, A., Middendorf, B., et al. (2008). Analysis of collection of hemolytic uremic syndrome-associated enterohemorrhagic Escherichia coli. Emerg. Infectar. Dis. 14, 1287�. doi: 10.3201/eid1408.071082

Morabito, S., Karch, H., Mariani-Kurkdjian, P., Schmidt, H., Minelli, F., Bingen, E., et al. (1998). Enteroaggregative, Shiga toxin-producing Escherichia coli O111:H2 associated with an outbreak of hemolytic-uremic syndrome. J. Clin. Microbiol. 36, 840�. doi: 10.1128/JCM.36.3.840-842.1998

Nejman-Faleᑌzyk, B., Golec, P., Maciąg, M., Wegrzyn, A., and Wêgrzyn, G. (2012). Inhibition of development of Shiga toxin-converting bacteriophages by either treatment with citrate or amino acid starvation. Foodborne Pathog. Dis. 9, 13�. doi: 10.1089/fpd.2011.0980

Nowicki, D., Kobiela, W., Wêgrzyn, A., Wegrzyn, G., and Szalewska-Paᐪsz, A. (2013). ppGpp-dependent negative control of DNA replication of Shiga toxin-converting bacteriophages in Escherichia coli. J. Bacteriol. 195, 5007�. doi: 10.1128/JB.00592-13

O𠆛rien, A. D., Marques, L. R., Kerry, C. F., Newland, J. W., and Holmes, R. K. (1989). Shiga-like toxin converting phage of enterohemorrhagic Escherichia coli strain 933. Microb. Pathog. 6, 381�. doi: 10.1016/0882-4010(89)90080-6

O’Leary, N. A., Wright, M. W., Brister, J. R., Ciufo, S., Haddad, D., McVeigh, R., et al. (2016). Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Ácidos nucleicos Res. 44, D733�. doi: 10.1093/nar/gkv1189

Plunkett, G. III, Rose, D. J., Durfee, T. J., and Blattner, F. R. (1999). Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product. J. Bacteriol. 181, 1767�. doi: 10.1128/JB.181.6.1767-1778.1999

Ptashne, M. (2004). A Genetic Switch Phage Lambda Revevisited, 3ª Ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Rasko, D. A., Webster, D. R., Sahl, J. W., Bashir, A., Boisen, N., Scheutz, F., et al. (2011). Orígenes de la E. coli strain causing an outbreak of hemolytic-uremic syndrome in Germany. N. Engl. J. Med. 365, 709�. doi: 10.1056/NEJMoa1106920

Riley, L. W., Remis, R. S., Helgerson, S. D., McGee, H. B., Wells, J. G., Davis, B. R., et al. (1983). Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308, 681�. doi: 10.1056/NEJM198303243081203

Sato, T., Shimizu, T., Watarai, M., Kobayashi, M., Kano, S., Hamabata, T., et al. (2003). Genome analysis of a novel Shiga toxin 1 (Stx1)-converting phage which is closely related to Stx2-converting phages but not to other Stx1-converting phages. J. Bacteriol. 185, 3966�. doi: 10.1128/jb.185.13.3966-3971.2003

Scheutz, F., Teel, L. D., Beutin, L., Piérard, D., Buvens, G., Karch, H., et al. (2012). Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J. Clin. Microbiol. 50, 2951�. doi: 10.1128/JCM.00860-12

Schimmer, B., Nygard, K., Eriksen, H. M., Lassen, J., Lindstedt, B. A., Brandal, L. T., et al. (2008). Outbreak of haemolytic uraemic syndrome in Norway caused by stx2-positive Escherichia coli O103:H25 traced to cured mutton sausages. BMC Infect. Dis. 8:41. doi: 10.1186/1471-2334-8-41

Schmidt, H. (2001). Shiga-toxin-converting bacteriophages. Res. Microbiol. 152, 687�. doi: 10.1016/s0923-2508(01)01249-9

Schmidt, H., Bielaszewska, M., and Karch, H. (1999). Transduction of enteric Escherichia coli isolates with a derivative of Shiga toxin 2-encoding bacteriophage phi3538 isolated from Escherichia coli O157: H7. Apl. Reinar. Microbiol. 65, 3855�. doi: 10.1128/AEM.65.9.3855-3861.1999

Serra-Moreno, R., Acosta, S., Hernalsteens, J. P., Jofre, J., and Muniesa, M. (2006). Use of the lambda red recombinase system to produce recombinant prophages carrying antibiotic resistance genes. BMC Mol. Biol. 7:31. doi: 10.1186/1471-2199-7-31

Shearwin, K. E., Brumby, A. M., and Egan, J. B. (1998). The Tum protein of coliphage 186 is an antirepressor. J. Biol. Chem. 273, 5708�. doi: 10.1074/jbc.273.10.5708

Sikorski, M. J., Hazen, T. H., Vyas, G., Michalski, J. M., and Rasko, D. A. (2020). Genome sequences of four Shigella boydii strains representative of the major S. boydii clados. Microbiol. Resour. Announc. 9:e00881-20. doi: 10.1128/MRA.00881-20

Smith, D. L., Rooks, D. J., Fogg, P. C., Darby, A. C., Thomson, N. R., McCarthy, A. J., et al. (2012). Comparative genomics of Shiga toxin encoding bacteriophages. BMC Genomics 13:311. doi: 10.1186/1471-2164-13-311

Taylor, E. V., Nguyen, T. A., Machesky, K. D., Koch, E., Sotir, M. J., Bohm, S. R., et al. (2013). Multistate outbreak of Escherichia coli O145 infections associated with romaine lettuce consumption, 2010. J. Food Prot. 76, 939�. doi: 10.4315/0362-028X.JFP-12-503

Torres, A. G., Vazquez-Juarez, R. C., Tutt, C. B., and Garcia-Gallegos, J. G. (2005). Pathoadaptive mutation that mediates adherence of Shiga toxin-producing Escherichia coli O111. Infectar. Immun. 73, 4766�. doi: 10.1128/IAI.73.8.4766-4776.2005

Unkmeir, A., and Schmidt, H. (2000). Structural analysis of phage-borne stx genes and their flanking sequences in Shiga toxin-producing Escherichia coli y Shigella dysenteriae type 1 strains. Infectar. Immun. 68, 4856�. doi: 10.1128/iai.68.9.4856-4864.2000

Wagner, P. L., Acheson, D. W., and Waldor, M. K. (1999). Isogenic lysogens of diverse Shiga toxin 2-encoding bacteriophages produce markedly different amounts of Shiga toxin. Infectar. Immun. 67, 6710�. doi: 10.1128/iai.67.12.6710-6714.1999

Wegrzyn, G., and Wegrzyn, A. (2005). Genetic switches during bacteriophage lambda development. Prog. Nucleic Acid Res. Mol. Biol. 79, 1�. doi: 10.1016/S0079-6603(04)79001-7

Yin, S., Rusconi, B., Sanjar, F., Goswami, K., Xiaoli, L., Eppinger, M., et al. (2015). Escherichia coli O157:H7 strains harbor at least three distinct sequence types of Shiga toxin 2a-converting phages. BMC Genomics 16:733. doi: 10.1186/s12864-015-1934-1

Zeng, L., Skinner, S. O., Zong, C., Sippy, J., Feiss, M., and Golding, I. (2010). Decision making at a subcellular level determines the outcome of bacteriophage infection. Celda 141, 682�. doi: 10.1016/j.cell.2010.03.034

Zhou, Z., Alikhan, N. F., Mohamed, K., Fan, Y., and Achtman, M. (2020). The enterobase user’s guide, with case studies on Salmonela transmissions, Yersinia pestis phylogeny, and Escherichia core genomic diversity. Genome Res. 30, 138�. doi: 10.1101/gr.251678.119

Keywords : EHEC, bacteriophage lambda, lytic, phage replication, lysogen, Stx phage

Citation: Llarena A-K, Aspholm M, O’Sullivan K, Wêgrzyn G and Lindb์k T (2021) Replication Region Analysis Reveals Non-lambdoid Shiga Toxin Converting Bacteriophages. Parte delantera. Microbiol. 12:640945. doi: 10.3389/fmicb.2021.640945

Received: 12 December 2020 Accepted: 16 February 2021
Published: 18 March 2021.

Maite Muniesa, University of Barcelona, Spain

Magaly Toro, University of Chile, Chile
Camilla Sekse, Norwegian Veterinary Institute (NVI), Norway

Copyright © 2021 Llarena, Aspholm, O’Sullivan, Wêgrzyn and Lindb์k. Este es un artículo de acceso abierto distribuido bajo los términos de la Licencia de atribución Creative Commons (CC BY). Se permite el uso, distribución o reproducción en otros foros, siempre que se acredite al autor (es) original (es) y al propietario (es) de los derechos de autor y se cite la publicación original en esta revista, de acuerdo con la práctica académica aceptada. No se permite ningún uso, distribución o reproducción que no cumpla con estos términos.


Ver el vídeo: Bacteriophage Virus 3d model DIY (Mayo 2022).